Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338809

Morpholino Name: map2k1 AGT MO1
Synonyms: Mek1 MO ATG, Mk-MO ATG
Target mRNA: map2k1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TGGGCGTAGGCTTCTTTTTAGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' ATGCCTAAGAAGAAGCCTACGCCCA 3' |||||||| |||||||||||||||| 3' TACGGATTTTTCTTCGGATGCGGGT 5' 5' ATGCCTAAAAAGAAGCCTACGCCCA 3' ||||||||||||||||||||||||| 3' TACGGATTTTTCTTCGGATGCGGGT 5' 5' ATGCCTAAAAAGAAGCCTACGCCCA 3' ||||||||||||||||||||||||| 3' TACGGATTTTTCTTCGGATGCGGGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:108263206..108263230 25/25 Antisense target map2k1.L
chr3S:35864573..35864597 25/25 Antisense target map2k1.S
chr3S:35864573..35864597 25/25 Sense off-target tipin.S
Scaffold34:1778940..1778964 21/25 Sense off-target mta1.S
tropicalis 10.0 Chr3:117143754..117143778 24/25 Antisense target map2k1
Publications
First: Lineage commitment of embryonic cells involves MEK1-dependent clearance of pluripotency regulator Ventx2., Elife 2017                                
Most recent:
View All Papers