Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338810

Morpholino Name: map2k1 MO2
Synonyms: Mek1 MO, Mk-MO
Target mRNA: map2k1

Morpholino Type: translation blocking morpholino
Sequence: 5' TGAGTGGAGAGCAGAGCGAGTGCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGGCACTCGCTCTGCTCTCCACTCA 3' ||||||||||||||||||||||||| 3' CCCGTGAGCGAGACGAGAGGTGAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:108263173..108263197 25/25 Antisense target map2k1.L
chr2L:174724551..174724575 22/25 Antisense off-target art1.L
chr7L:19652705..19652729 22/25 Antisense off-target adam12.L
tropicalis 10.0 Chr5:76655363..76655387 21/25 Sense off-target tube1
Publications
First: Lineage commitment of embryonic cells involves MEK1-dependent clearance of pluripotency regulator Ventx2., Elife 2017                                
Most recent:
View All Papers