Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338852

Morpholino Name: dbf4b MO1
Synonyms: drf1 MO, drf1MO
mRNA Target: dbf4b

Morpholino Type: uncategorized morpholino
Sequence:
5' GCAGAACAGAGATCACACTGGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGCCAGTGTGATCTCTGTTCTGC 3' ||||||||||||||||||||||||| 3' TACCGGTCACACTAGAGACAAGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold75417:2334205..2334229 25/25 Antisense target dbf4b
Scaffold149581:1792549..1792573 21/25 unknown
Scaffold9994:5928110..5928134 21/25 unknown
Publications
First: Titration of four replication factors is essential for the Xenopus laevis midblastula transition., Science 2013  
Most recent: Chk1 Inhibition of the Replication Factor Drf1 Guarantees Cell-Cycle Elongation at the Xenopus laevis Mid-blastula Transition., Dev Cell 2017                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556