Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338900

Morpholino Name: otx1 MO1
Synonyms:
mRNA Target: otx1

Morpholino Type: uncategorized morpholino
Sequence:
5' TAGGACATCATGCTCAAGGCTGGAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GTCCAGCCTTGAGCATGATGTCATA 3' ||||||||||||||||||||| || 3' TAGGTCGGAACTCGTACTACAGGAT 5' 5' ATCCAGCCTTGAGCATGATGTCCTA 3' ||||||||||||||||||||||||| 3' TAGGTCGGAACTCGTACTACAGGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12020:6251771..6251795 25/25 Antisense target otx1
Scaffold30483:956744..956768 21/25 unknown
tropicalis 7.1 scaffold_5:94039275..94039299 23/25 Antisense target otx1
scaffold_2:8168942..8168966 21/25 unknown
Publications
First: High-throughput analysis reveals novel maternal germline RNAs crucial for primordial germ cell preservation and proper migration., Development 2017                                                                                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556