Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18339076

Morpholino Name: myh4 MO1
Synonyms:
mRNA Target: myh4

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTCCTGCCCTGGTCTCTGTGATCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold163806:3264359..3264384 23/26 Antisense off-target myh10
Scaffold113759:1145734..1145759 22/26 unknown
Scaffold137358:64..89 22/26 unknown
Scaffold15436:6422956..6422981 22/26 unknown
Scaffold81941:811073..811098 22/26 unknown
Publications
First: Sorting at embryonic boundaries requires high heterotypic interfacial tension., Nat Commun 2017                                        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556