Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18339090

Morpholino Name: vangl2 MO5
Synonyms:
mRNA Target: vangl2

Morpholino Type:
Sequence:
5' ACTGGGAATCATTGTCCATGTTTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' GAAAACATGGACAACGACTCCCAGT 3' |||||||||||||| || ||||||| 3' CTTTTGTACCTGTTACTAAGGGTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold41091:2015295-2015319 25/25 Antisense off-target vangl2-b
Scaffold226:554557-554581 24/25 Antisense off-target vangl2-a
Scaffold43791:4830565-4830589 22/25 unknown
Scaffold27067:1213942-1213966 21/25 Antisense off-target paox
Scaffold44061:3269339-3269363 21/25 Sense off-target Xelaev16054420m
Scaffold58038:3050241-3050265 21/25 unknown
Scaffold90041:847448-847472 21/25 Sense off-target Xelaev16077962m
tropicalis 7.1 scaffold_8c:2756808-2756832 23/25 Antisense target vangl2
scaffold_10:2132279-2132303 21/25 Sense off-target myocd
Publications
First: hmmr mediates anterior neural tube closure and morphogenesis in the frog Xenopus. [Dev Biol 2017]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556