Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18373971

Morpholino Name: vgll3 MO1
Synonyms:
mRNA Target: vgll3

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCAGAACTGCTGTCTAGTGGCACC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' GGTGACACTGGCCAGCAGTTCTGCA 3' |||| |||| | |||||||||||| 3' CCACGGTGATCTGTCGTCAAGACGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold6590:13441495..13441519 25/25 Antisense off-target Xelaev16067649m
Scaffold15415:4039891..4039915 22/25 Antisense off-target Xelaev16015544m
Scaffold195950:1592434..1592458 21/25 Sense off-target Xelaev16024807m
tropicalis 7.1 scaffold_2:112431251..112431275 21/25 Antisense target vgll3
Publications
First: Vestigial-like 3 is a novel Ets1 interacting partner and regulates trigeminal nerve formation and cranial neural crest migration., Biol Open 2017                                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556