Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18373972

Morpholino Name: vgll3 MO2
Synonyms: v3LMOe2i2 (v3LMOsp)
mRNA Target: vgll3

Morpholino Type: splice blocking morpholino (E2-I2)
Sequence:
5' GAGAAGCCATATTTGCTTACCCCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' GAAGGGTAAGCAAACATTGCTTCTC 3' || ||||||||||| || ||||||| 3' CTCCCCATTCGTTTATACCGAAGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold6590:13449345..13449369 25/25 Antisense off-target Xelaev16067649m
Scaffold22127:3827906..3827930 21/25 unknown
Scaffold231526:1238244..1238268 21/25 Sense off-target safb
Scaffold35184:175249..175273 21/25 unknown
Scaffold8006:1142213..1142237 21/25 Antisense off-target epb41l3
Scaffold81267:2027112..2027136 21/25 unknown
Scaffold99286:1662442..1662466 21/25 unknown
tropicalis 7.1 scaffold_2:112439818..112439842 22/25 Antisense target vgll3
Publications
First: Vestigial-like 3 is a novel Ets1 interacting partner and regulates trigeminal nerve formation and cranial neural crest migration., Biol Open 2017                                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556