Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18373977

Morpholino Name: tead1 MO1
Synonyms: T1MO
mRNA Target: tead1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCCAACTGCTCGGCTCCATGATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold25194:4070546..4070570 25/25 unknown
Scaffold43483:5440897..5440921 25/25 unknown
Scaffold195950:94456..94480 21/25 unknown
Scaffold279021:3748..3772 21/25 unknown
Scaffold52702:6331135..6331159 21/25 Sense off-target phf3
tropicalis 7.1 scaffold_4:2699598..2699622 24/25 unknown
Publications
First: Vestigial-like 3 is a novel Ets1 interacting partner and regulates trigeminal nerve formation and cranial neural crest migration., Biol Open 2017                                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556