Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374197

Morpholino Name: intu MO2
Synonyms: inturned
Target mRNA: intu

Morpholino Type: uncategorized morpholino
Sequence: 5' ATATTCCCCTTACCTATTAGAACCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGGTTCTAATAGGTAAGGGGAATAT 3' ||||||||||||||||||||||||| 3' TCCAAGATTATCCATTCCCCTTATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:52612906..52612930 25/25 Antisense target intu.S
Publications
First: The ciliopathy-associated CPLANE proteins direct basal body recruitment of intraflagellar transport machinery., Nat Genet 2016                                
Most recent:
View All Papers