Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374208

Morpholino Name: ift46 MO1
Synonyms:
mRNA Target: ift46

Morpholino Type:
Sequence:
5' GATGTGTTTCTGCCTCTTCCATCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24
genomic

MO
5' GGATGGAAGAGGCAGAAACAGATG 3' |||||||||||||||||||| || 3' CCTACCTTCTCCGTCTTTGTGTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold261090:900..923 22/24 Antisense target ift46
Scaffold287959:3026225..3026248 22/24 Antisense off-target Xelaev16038880m
Scaffold14870:748137..748160 20/24 Antisense off-target Xelaev16014102m
Scaffold163806:3254581..3254604 20/24 unknown
Scaffold220499:1788229..1788252 20/24 unknown
Scaffold23403:3050871..3050894 20/24 unknown
Scaffold377:402711..402734 20/24 unknown
Scaffold63567:122592..122615 20/24 unknown
Scaffold939:4014954..4014977 20/24 Sense off-target glis2-b
tropicalis 7.1 scaffold_1:147651286..147651309 20/24 Antisense off-target grid2
scaffold_1:163601673..163601696 20/24 Antisense off-target naa15
scaffold_1:16520189..16520212 20/24 unknown
scaffold_1:21409506..21409529 20/24 unknown
scaffold_1:37668892..37668915 20/24 unknown
scaffold_2:30983893..30983916 20/24 unknown
scaffold_2:31014571..31014594 20/24 unknown
scaffold_2582:3726..3749 20/24 unknown
scaffold_4:31308587..31308610 20/24 unknown
scaffold_5:4304005..4304028 20/24 Antisense off-target c3orf21
Publications
First: IFT46 plays crucial roles in craniofacial and cilia development. [Biochem Biophys Res Commun 2016]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556