Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374210

Morpholino Name: tbx3 MO4
Synonyms:
mRNA Target: tbx3

Morpholino Type: translation blocking morpholino
Sequence:
5' GCACCCTTTGGATGTCACCGTTTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold44061:1134706..1134730 25/25 Antisense off-target tbx3-b
Publications
First: Tbx3 represses bmp4 expression and, with Pax6, is required and sufficient for retina formation., Development 2016                                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556