Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374210

Morpholino Name: tbx3 MO4
Synonyms:
Target mRNA: tbx3

Morpholino Type: translation blocking morpholino
Sequence: 5' GCACCCTTTGGATGTCACCGTTTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CCAAACGGTGACATCCAAAGGGTGC 3' ||||||||||||||||||||||||| 3' GGTTTGCCACTGTAGGTTTCCCACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:119199151..119199175 25/25 Antisense target tbx3.S
Publications
First: Tbx3 represses bmp4 expression and, with Pax6, is required and sufficient for retina formation., Development 2016                                        
Most recent:
View All Papers