Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374211

Morpholino Name: tbx3 MO5
Synonyms:
mRNA Target: tbx3

Morpholino Type: splice blocking morpholino
Sequence:
5' GAGACAATGGCTGAGACTCACCTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' GGAGGTGAGTCTCAGCCTTTGTCTT 3' ||||||||||||||||| |||||| 3' CCTCCACTCAGAGTCGGTAACAGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold229342:650036..650060 25/25 Antisense off-target tbx3-a
Scaffold44061:1135125..1135149 23/25 Antisense off-target tbx3-b
Scaffold12518:14392165..14392189 21/25 Sense off-target Xelaev16007443m
tropicalis 7.1 scaffold_1:62141893..62141917 23/25 Antisense target tbx3
Publications
First: Tbx3 represses bmp4 expression and, with Pax6, is required and sufficient for retina formation., Development 2016                                        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.0


Major funding for Xenbase is provided by grant P41 HD064556