Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374211

Morpholino Name: tbx3 MO5
Synonyms:
Target mRNA: tbx3

Morpholino Type: splice blocking morpholino
Sequence: 5' GAGACAATGGCTGAGACTCACCTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 23/25
genomic

MO
5' GGAGGTGAGTCTCAGCCTTTGTCTT 3' ||||||||||||||||| |||||| 3' CCTCCACTCAGAGTCGGTAACAGAG 5' 5' GGAGGTGAGTCTCAGCCATTGTCTC 3' ||||||||||||||||||||||||| 3' CCTCCACTCAGAGTCGGTAACAGAG 5' 5' GGAGGTGAGTCACAGCCTTTGTCTC 3' ||||||||||| ||||| ||||||| 3' CCTCCACTCAGAGTCGGTAACAGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:144722236..144722260 25/25 Antisense target tbx3.L
chr1S:119199570..119199594 23/25 Antisense target tbx3.S
chr3L:71155965..71155989 21/25 Sense off-target sema3d.L
tropicalis 10.0 Chr1:145776128..145776152 23/25 Antisense target tbx3
Publications
First: Tbx3 represses bmp4 expression and, with Pax6, is required and sufficient for retina formation., Development 2016                                        
Most recent:
View All Papers