Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374212

Morpholino Name: epha7 MO1
Synonyms:
mRNA Target: epha7

Morpholino Type:
Sequence:
5' TAATCCAGGAAGCATGTAGAGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold22185:1949362..1949386 25/25 Antisense off-target Xelaev16029018m
Publications
First: EphA7 modulates apical constriction of hindbrain neuroepithelium during neurulation in Xenopus., Biochem Biophys Res Commun 2016          
Most recent: EphA7 regulates claudin6 and pronephros development in Xenopus., Biochem Biophys Res Commun 2018          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.1


Major funding for Xenbase is provided by grant P41 HD064556