Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374212

Morpholino Name: epha7 MO1
Synonyms:
mRNA Target: epha7

Morpholino Type:
Sequence:
5' TAATCCAGGAAGCATGTAGAGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold22185:1949362..1949386 25/25 Antisense off-target Xelaev16029018m
Publications
First: EphA7 modulates apical constriction of hindbrain neuroepithelium during neurulation in Xenopus. [Biochem Biophys Res Commun 2016]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556