Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374221

Morpholino Name: kbtbd8 MO1
Synonyms: kbtbd8 translation blocking
mRNA Target: kbtbd8

Morpholino Type: Translation Blocking()
Sequence:
5' GTGCAGGAAACGTCACTTACTTCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGGAAGTAAGTGACGTTTCCTGCAC 3' ||||||||||||||||||||||||| 3' TCCTTCATTCACTGCAAAGGACGTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold154579:1825878-1825902 24/25 Antisense off-target Xelaev16015908m
Scaffold34527:4119838-4119862 22/25 unknown
Scaffold1187:1617269-1617293 21/25 Antisense off-target Xelaev16004798m
Scaffold149890:4808241-4808265 21/25 Antisense off-target Xelaev16014723m
tropicalis 7.1 scaffold_4:132176053-132176077 25/25 Antisense target kbtbd8
Publications
First: Cell-fate determination by ubiquitin-dependent regulation of translation. [Nature 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556