Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374222

Morpholino Name: kbtbd8 MO2
Synonyms: kbtbd8 splice blocking
mRNA Target: kbtbd8

Morpholino Type: Splice Blocking()
Sequence:
5' TCTCCCAGCCCCAAACAACC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

MO
5' GGTTGTTTGGGGCTGGGAGA 3' |||||||||||||||||||| 3' CCAACAAACCCCGACCCTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold396:538093..538112 18/20 unknown
Scaffold51452:3879954..3879973 18/20 Sense off-target Xelaev16059068m
Scaffold96766:112260..112279 18/20 Antisense off-target Xelaev16080035m
Scaffold99185:469894..469913 18/20 Sense off-target Xelaev16080904m
Scaffold16807:5763601..5763620 17/20 Antisense off-target Xelaev16019470m
Scaffold245292:350054..350073 17/20 unknown
Scaffold384312:3..22 17/20 unknown
Scaffold58049:4463760..4463779 17/20 unknown
Scaffold97703:1420312..1420331 17/20 unknown
Scaffold111824:6087162..6087181 16/20 Antisense off-target Xelaev16003046m
Scaffold167300:764265..764284 16/20 unknown
tropicalis 7.1 scaffold_4:132175983..132176002 20/20 Antisense target kbtbd8
scaffold_6:41136597..41136616 19/20 unknown
scaffold_2:105283620..105283639 17/20 unknown
scaffold_3:13126166..13126185 17/20 unknown
scaffold_5:50858992..50859011 17/20 unknown
scaffold_7:66158111..66158130 17/20 unknown
scaffold_4:60877708..60877727 16/20 unknown
scaffold_8:24174771..24174790 16/20 unknown
Publications
First: Cell-fate determination by ubiquitin-dependent regulation of translation. [Nature 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556