Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374231

Morpholino Name: rras MO1
Synonyms:
mRNA Target: rras

Morpholino Type: translation blocking morpholino
Sequence:
5' GCTCCTTGGAACTCATAGTCGCTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold129797:525742..525766 25/25 Antisense off-target Xelaev16008521m
Scaffold29769:1852125..1852149 24/25 Antisense off-target Xelaev16039873m
Publications
First: miR-34/449 control apical actin network formation during multiciliogenesis through small GTPase pathways., Nat Commun 2015                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556