Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374232

Morpholino Name: rras miR-449 protector MO
Synonyms: PO-rras
mRNA Target: rras

Morpholino Type: uncategorized morpholino
Sequence:
5' GTTGGCAATGTAGGTGCAATTCGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold129797:562760..562784 25/25 Antisense off-target Xelaev16008521m
Scaffold137879:398541..398565 21/25 unknown
Scaffold298574:1715888..1715912 21/25 Sense off-target Xelaev16040023m
Publications
First: miR-34/449 control apical actin network formation during multiciliogenesis through small GTPase pathways., Nat Commun 2015                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556