Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374233

Morpholino Name: dll1 miR-449 protector MO1
Synonyms:
mRNA Target: dll1

Morpholino Type: uncategorized morpholino
Sequence:
5' CGGCAGTGCAACAGTTTATGTCTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CCAGACATAAACTGTTGCACTGCCG 3' ||||||||||||||||||||||||| 3' GGTCTGTATTTGACAACGTGACGGC 5' 5' CCAGACATAAACTGTTGCACTGCCG 3' ||||||||||||||||||||||||| 3' GGTCTGTATTTGACAACGTGACGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold176005:335098..335122 25/25 Antisense target dll1
Scaffold34423:2005788..2005812 25/25 Antisense off-target Xelaev16045005m
tropicalis 7.1 scaffold_5:73324063..73324087 25/25 Antisense target dll1
scaffold_1:141513022..141513046 21/25 unknown
Publications
First: miR-34/449 control apical actin network formation during multiciliogenesis through small GTPase pathways., Nat Commun 2015                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556