Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374337

Morpholino Name: ern1 MO2
Synonyms:
mRNA Target: ern1

Morpholino Type: uncategorized morpholino
Sequence:
5' AAGAGAACCGCCAGAGGCGCCATGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold3490:1431613..1431637 25/25 Sense off-target Xelaev16045904m
Scaffold152894:3466283..3466307 21/25 unknown
Publications
First: IRE1α is essential for Xenopus pancreas development., J Biomed Res 2014                
Most recent: IRE1α knockdown rescues tunicamycin-induced developmental defects and apoptosis in Xenopus laevis., J Biomed Res 2014          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556