Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374353

Morpholino Name: ascl1 MO4
Synonyms: Ascl1b MOb
mRNA Target: ascl1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GTCTCCATGCTGATAGGCTGATGAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATCATCAGCCTATCAGCATGGAGAC 3' ||||||||||||||||||||||||| 3' TAGTAGTCGGATAGTCGTACCTCTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:95729570..95729594 25/25 Antisense target ascl1.S
chr9_10L:14641258..14641282 21/25 Sense off-target rbbp8nl.L
chr9_10L:14641258..14641282 21/25 Antisense off-target LOC108700924
chr9_10S:49106554..49106578 21/25 unknown
tropicalis 10.0 Chr2:57424258..57424282 21/25 unknown
Chr4:99669413..99669437 21/25 unknown
Publications
First: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers