Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374355

Morpholino Name: ascl1 mismatch cMO2
Synonyms:
mRNA Target: ascl1

Morpholino Type: control morpholino (ATG)
Sequence:
5' CACTTCTCCATCCTCACACGCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:142904707..142904728 19/22 Antisense off-target chrnb1.L
chr8L:83531389..83531410 19/22 unknown
chr9_10S:1522369..1522390 19/22 unknown
Scaffold31:999767..999788 18/22 unknown
chr4S:111199433..111199454 18/22 Antisense off-target il17re.S
chr5L:137345999..137346020 18/22 Sense off-target mboat2.L
tropicalis 10.0 Chr3:101377506..101377527 18/22 Antisense off-target wdr72
Publications
First:
Most recent:
View All Papers