Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374358

Morpholino Name: tcf21 MO4
Synonyms:
mRNA Target: tcf21

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' GATCAAGGTGTGACTGAATGCAATA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' TGTTGTATTCAGTCACACCTTGGTC 3' | ||| |||||||||||||||| || 3' ATAACGTAAGTCAGTGTGGAACTAG 5' 5' TATTGCATTCAGTCACACCTTGATC 3' ||||||||||||||||||||||||| 3' ATAACGTAAGTCAGTGTGGAACTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold6529:511844..511868 25/25 Antisense target tcf21
Scaffold29306:20829..20853 24/25 Antisense off-target Xelaev16039321m
Scaffold373526:94688..94712 21/25 unknown
tropicalis 7.1 scaffold_2:77252077..77252101 22/25 unknown
scaffold_5:55950808..55950832 22/25 Antisense target tcf21
Publications
First: Tcf21 regulates the specification and maturation of proepicardial cells., Development 2013                                  
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556