Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374381

Morpholino Name: angptl4 MO1
Synonyms:
Target mRNA: angptl4

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTATCTGACCTGAAAGGTGTTTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 23/25
genomic

MO
5' CCAAACACCTTTCAGGTCAGATAAA 3' ||||||||||||||||||||||||| 3' GGTTTGTGGAAAGTCCAGTCTATTT 5' 5' CCAAACACCTTTCAGGTCAGATGAG 3' |||||||||||||||||||||| | 3' GGTTTGTGGAAAGTCCAGTCTATTT 5' 5' CCAAACACCTTTCAGGTCAGAAAAG 3' ||||||||||||||||||||| || 3' GGTTTGTGGAAAGTCCAGTCTATTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:98488123..98488147 23/25 Antisense target angptl4.L
chr1S:86792698..86792722 23/25 Antisense target angptl4.S
chr6S:14878708..14878732 21/25 Antisense off-target pard3.S
chr6S:90303002..90303026 21/25 unknown
chr7S:37810422..37810446 21/25 unknown
chr2S:52504880..52504904 21/25 unknown
tropicalis 10.0 Chr1:101425056..101425080 25/25 Antisense target angptl4
Chr1:101425056..101425080 25/25 Sense off-target LOC105945731
Chr1:101425056..101425080 25/25 Sense off-target Xetrov107003482m.g
Chr1:75713767..75713791 21/25 unknown
Chr2:124926466..124926490 21/25 unknown
Chr4:78407769..78407793 21/25 unknown
Chr5:117238813..117238837 21/25 unknown
Publications
First: Angiopoietin-like 4 Is a Wnt Signaling Antagonist that Promotes LRP6 Turnover., Dev Cell 2017                                  
Most recent:
View All Papers