Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374382

Morpholino Name: angptl4 MO2
Synonyms:
mRNA Target: angptl4

Morpholino Type: uncategorized morpholino
Sequence:
5' TGTCGGCCACTCACTTGAAACAATA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_1:146500316..146500340 21/25 Antisense off-target fam190a
scaffold_6:138693476..138693500 21/25 unknown
Publications
First: Angiopoietin-like 4 Is a Wnt Signaling Antagonist that Promotes LRP6 Turnover., Dev Cell 2017                                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556