Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374382

Morpholino Name: angptl4 MO2
Synonyms:
mRNA Target: angptl4

Morpholino Type: uncategorized morpholino
Sequence:
5' TGTCGGCCACTCACTTGAAACAATA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 10.0 Chr1:78153315..78153339 21/25 Antisense off-target ccser1
Chr6:9505067..9505091 21/25 unknown
Publications
First: Angiopoietin-like 4 Is a Wnt Signaling Antagonist that Promotes LRP6 Turnover., Dev Cell 2017                                  
Most recent:
View All Papers