Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18375113

Morpholino Name: uchl5 MO1
Synonyms: Uch37
mRNA Target: uchl5

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' ACCATTCTCCTGCACTGCCCGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGGCGGGCAGTGCGGGAGAATGGT 3' |||||||||||||| |||||||||| 3' TACCGCCCGTCACGTCCTCTTACCA 5' 5' ATGGCGGGCAGTGCAGGAGAATGGT 3' ||||||||||||||||||||||||| 3' TACCGCCCGTCACGTCCTCTTACCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold78978:54321..54345 25/25 Antisense target uchl5
Scaffold23165:1649333..1649357 24/25 Antisense off-target Xelaev16030181m
tropicalis 7.1 scaffold_4:76751086..76751110 24/25 Antisense target uchl5
scaffold_2:35224433..35224457 21/25 unknown
scaffold_3:86776966..86776990 21/25 Antisense off-target grip1
scaffold_6:1639362..1639386 21/25 unknown
scaffold_8:22508861..22508885 21/25 unknown
scaffold_8:24418670..24418694 21/25 unknown
Publications
First: Ubiquitin C-terminal hydrolase37 regulates Tcf7 DNA binding for the activation of Wnt signalling., Sci Rep 2017                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556