Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18375588

Morpholino Name: pitx2 MO3
Synonyms:
mRNA Target: pitx2

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' GGTACAGTACAGTAGGCTCACAGAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold88765:4842078..4842102 23/25 Antisense off-target pitx2-b
Scaffold167628:707258..707282 21/25 unknown
Scaffold39723:4979839..4979863 21/25 unknown
Publications
First: Stomach curvature is generated by left-right asymmetric gut morphogenesis., Development 2017                        
Most recent: The left-right asymmetry of liver lobation is generated by Pitx2c-mediated asymmetries in the hepatic diverticulum., Dev Biol 2018                    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556