Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18375807

Morpholino Name: aqp3 MO1
Synonyms:
mRNA Target: aqp3

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CAAAATCCTTCTGGCGACCCATGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 24/25 21/25
genomic

MO
5' AGAATGGGACGCCAGAAGGATTTTA 3' | ||||| ||||||||||||||| 3' TTGTACCCAGCGGTCTTCCTAAAAC 5' 5' AACATGGGACGCCAGAAGGATTTTG 3' |||||||| |||||||||||||||| 3' TTGTACCCAGCGGTCTTCCTAAAAC 5' 5' AGAATGGGAAGCCAGAAGGATTTTG 3' | ||||| ||||||||||||||| 3' TTGTACCCAGCGGTCTTCCTAAAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:215423466..215423490 24/25 Antisense target aqp3.L
chr1S:178554889..178554913 21/25 Antisense target aqp3.S
tropicalis 10.0 Chr1:211028212..211028236 21/25 Antisense target aqp3
Publications
First: Roles for Xenopus aquaporin-3b (aqp3.L) during gastrulation: Fibrillar fibronectin and tissue boundary establishment in the dorsal margin., Dev Biol 2018                        
Most recent:
View All Papers