Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18375820

Morpholino Name: aqp3 MO2
Synonyms:
mRNA Target: aqp3

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' TTGGCTGGATCTCAGTTTGTCCTTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:16985507..16985531 21/25 Antisense off-target LOC108702031 [provisional:ogfrl1]
Scaffold113:220392..220416 25/25 unknown
Publications
First: Roles for Xenopus aquaporin-3b (aqp3.L) during gastrulation: Fibrillar fibronectin and tissue boundary establishment in the dorsal margin., Dev Biol 2018                        
Most recent:
View All Papers