Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18379661

Morpholino Name: zc4h2 MO1
Synonyms:
mRNA Target: zc4h2

Morpholino Type: uncategorized morpholino
Sequence:
5' GAATGAAATAAAATGCCAGCAAAAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold7546:518617..518641 25/25 Antisense off-target Xelaev16072241m
Scaffold137879:379952..379976 24/25 Antisense off-target Xelaev16011740m
Scaffold120240:3585864..3585888 22/25 Antisense off-target wipi2
Scaffold175847:345335..345359 22/25 Sense off-target Xelaev16021264m
Scaffold102262:1125245..1125269 21/25 unknown
Scaffold11199:1738789..1738813 21/25 Sense off-target Xelaev16003125m
Scaffold127187:2280011..2280035 21/25 unknown
Scaffold15415:3263497..3263521 21/25 unknown
Scaffold166674:2589644..2589668 21/25 unknown
Scaffold190777:322754..322778 21/25 unknown
Scaffold203280:66117..66141 21/25 Sense off-target Xelaev16026110m
Scaffold23403:9219704..9219728 21/25 unknown
Scaffold26364:6094660..6094684 21/25 unknown
Scaffold272406:153449..153473 21/25 unknown
Scaffold29621:526613..526637 21/25 unknown
Scaffold296596:820455..820479 21/25 unknown
Scaffold31653:3476582..3476606 21/25 Antisense off-target Xelaev16042379m
Scaffold43483:3836696..3836720 21/25 unknown
Scaffold62229:3149905..3149929 21/25 unknown
Scaffold7144:593871..593895 21/25 Sense off-target Xelaev16070049m
tropicalis 7.1 scaffold_7:5991412..5991436 24/25 unknown
scaffold_8:35068899..35068923 22/25 unknown
scaffold_8:83258155..83258179 22/25 unknown
scaffold_9:70949539..70949563 22/25 unknown
scaffold_1:124492022..124492046 21/25 Antisense off-target myo1f
scaffold_2:123432226..123432250 21/25 Antisense off-target amotl1
scaffold_2:25602246..25602270 21/25 Sense off-target ctps2
scaffold_5:58972476..58972500 21/25 unknown
scaffold_5:59213556..59213580 21/25 unknown
scaffold_5:68456184..68456208 21/25 unknown
scaffold_5:80905615..80905639 21/25 unknown
scaffold_5:84054003..84054027 21/25 unknown
scaffold_6:29959892..29959916 21/25 unknown
scaffold_7:42107926..42107950 21/25 unknown
scaffold_7:42137668..42137692 21/25 Sense off-target psd
Publications
First: ZC4H2 stabilizes Smads to enhance BMP signalling, which is involved in neural development in Xenopus., Open Biol 2017                            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556