Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18385371

Morpholino Name: trpm7 MO4
Synonyms: XTRPM7 MO3
mRNA Target: trpm7

Morpholino Type: uncategorized morpholino
Sequence:
5' GGGACATTCTGTTCAACGTGCAGAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' GTCTGCACGTTGAACAGAATGGTGA 3' ||||||||||||||||||||| 3' CAGACGTGCAACTTGTCTTACAGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:48304254..48304278 21/25 Antisense target trpm7.S
chr2L:32031511..32031535 21/25 Sense off-target myo18a.L
Publications
First: A Nonredundant Role for the TRPM6 Channel in Neural Tube Closure., Sci Rep 2017                      
Most recent:
View All Papers