Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18385571

Morpholino Name: pou5f3.3 MO7
Synonyms: oct60
mRNA Target: pou5f3.3

Morpholino Type: uncategorized morpholino
Sequence:
5' ATTGGTCCATTTCCAGCACTTGGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_2:94046938..94046962 21/25 Sense off-target ints6
scaffold_3:31201794..31201818 21/25 unknown
Publications
First: A novel role for sox7 in Xenopus early primordial germ cell development: mining the PGC transcriptome., Development 2018                                                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556