Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18385571

Morpholino Name: pou5f3.3 MO7
Synonyms: oct60
Target mRNA: pou5f3.3

Morpholino Type: uncategorized morpholino
Sequence: 5' ATTGGTCCATTTCCAGCACTTGGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' GAGCAAGTGCTGGAGATGGACCAGC 3' || ||||||||||| |||||||| 3' CTGGTTCACGACCTTTACCTGGTTA 5' 5' GACCAAGTGCTGGAAATGGACCAAT 3' ||||||||||||||||||||||||| 3' CTGGTTCACGACCTTTACCTGGTTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:27458411..27458435 25/25 Antisense target pou5f3.3.S
chr8L:2135322..2135346 21/25 Antisense target pou5f3.3.L
chr2S:132714787..132714811 21/25 Sense off-target ints6.S
chr6S:77304238..77304262 21/25 Sense off-target znf516.S
chr3S:59729731..59729755 21/25 unknown
chr8S:39138910..39138934 21/25 unknown
tropicalis 10.0 Chr2:149900152..149900176 21/25 Sense off-target ints6
Chr3:115046273..115046297 21/25 unknown
Publications
First: A novel role for sox7 in Xenopus early primordial germ cell development: mining the PGC transcriptome., Development 2018                                                  
Most recent:
View All Papers