Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18385580

Morpholino Name: ldb1 MO1
Synonyms:
mRNA Target: ldb1

Morpholino Type: uncategorized morpholino
Sequence:
5' GTCCCACATCTCGATCCAGCATGGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 23/25 23/25
genomic

MO
5' ACCATGCTGGATCGAGATGTGGGGT 3' ||||||||||||||||||||||| 3' TGGTACGACCTAGCTCTACACCCTG 5' 5' ACCATGCTGGATCGAGATGTGGGGT 3' ||||||||||||||||||||||| 3' TGGTACGACCTAGCTCTACACCCTG 5' 5' ACCATGCTGGATCGAGATGTGGGGT 3' ||||||||||||||||||||||| 3' TGGTACGACCTAGCTCTACACCCTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:26320964..26320988 23/25 Antisense target ldb1.L
chr7S:21187137..21187161 23/25 Antisense target ldb1.S
chr1L:37605755..37605779 21/25 Sense off-target slc25a4.L
tropicalis 10.0 Chr7:31942879..31942903 23/25 Antisense target ldb1
Publications
First: Early stages of induction of anterior head ectodermal properties in Xenopus embryos are mediated by transcriptional cofactor ldb1., Dev Dyn 2014                
Most recent:
View All Papers