Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18385686

Morpholino Name: rarb MO2
Synonyms: Rarb2.L, Rarbeta2.L
Target mRNA: rarb

Morpholino Type: uncategorized morpholino
Sequence: 5' GCACTTTCGCTGATATTCTGTAAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CTATACAGAATATCAGCGAAAGTGC 3' || |||||||||||||||||||||| 3' GAAATGTCTTATAGTCGCTTTCACG 5' 5' CTTTACAGAATATCAGCGAAAGTGC 3' ||||||||||||||||||||||||| 3' GAAATGTCTTATAGTCGCTTTCACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:45319630..45319654 25/25 Sense target rarb.L
chr6L:45319630..45319654 25/25 Antisense off-target eomes.L
chr1S:128488225..128488249 21/25 Sense off-target ankle2.S
chr2S:150126575..150126599 22/25 unknown
tropicalis 10.0 Chr6:47515701..47515725 24/25 Sense target rarb
Chr10:17832010..17832034 21/25 unknown
Chr2:147194681..147194705 21/25 unknown
Publications
First: RARβ2 is required for vertebrate somitogenesis., Development 2017                                                
Most recent:
View All Papers