Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18386356

Morpholino Name: gli3 MO3
Synonyms:
mRNA Target: gli3

Morpholino Type: uncategorized morpholino
Sequence:
5' GACTGGGCTTCCATGTTGTCTTCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAGAAGACAACATGGAAGCCCAGTC 3' ||||||||||||||||||||||||| 3' CTCTTCTGTTGTACCTTCGGGTCAG 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_6:85834428..85834452 25/25 Antisense target gli3
scaffold_5558:1343..1367 21/25 unknown
scaffold_7:44875203..44875227 21/25 unknown
Publications
First: Inversion of Sonic hedgehog action on its canonical pathway by electrical activity., Proc Natl Acad Sci U S A 2015                                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556