Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18386371

Morpholino Name: rapgef5 MO1
Synonyms:
mRNA Target: rapgef5

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CTTTAAAAGTCTGACACCCATGAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_6:105766537..105766561 25/25 unknown
Publications
First: RAPGEF5 Regulates Nuclear Translocation of β-Catenin., Dev Cell 2018                                                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556