Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18396004

Morpholino Name: otogl MO1
Synonyms:
mRNA Target: otogl2

Morpholino Type: splice blocking morpholino
Sequence:
5' TAGAGTCATACATACCTCCATCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_7:104647025..104647049 25/25 unknown
scaffold_4:90138755..90138779 21/25 Antisense off-target fubp1
scaffold_8:36331017..36331041 21/25 Sense off-target diaph2
Publications
First: A secretory cell type develops alongside multiciliated cells, ionocytes and goblet cells, and provides a protective, anti-infective function in the frog embryonic mucociliary epidermis., Development 2014                                  
Most recent: Functional characterization of the mucus barrier on the Xenopus tropicalis skin surface., Proc Natl Acad Sci U S A 2018                    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556