Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18396232

Morpholino Name: acvrl1 MO1
Synonyms: ALK1 MO, ALK1MO
mRNA Target: acvrl1

Morpholino Type: uncategorized morpholino
Sequence:
5' GTTTTCAGGTGACACAGGAGCAGCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_2:76666722..76666746 22/25 unknown
Publications
First: ADMP controls the size of Spemann''s organizer through a network of self-regulating expansion-restriction signals., BMC Biol 2018                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556