Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18396331

Morpholino Name: larp6 MO1
Synonyms:
mRNA Target: larp6

Morpholino Type: uncategorized morpholino
Sequence:
5' TCTCCTCGGGCTCCTCCATGTCACT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: La-related protein 6 controls ciliated cell differentiation., Cilia 2017                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556