Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18396964

Morpholino Name: tbxt.2 MO4
Synonyms: t2 MO, t2 MOsplice
mRNA Target: tbxt.2

Morpholino Type: splice blocking morpholino
Sequence:
5' GAAAGGTCCATATTCTCTTACCTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAAGGTAAGAGAATATGGACCTTTC 3' ||||||||||||||||||||||||| 3' CTTCCATTCTCTTATACCTGGAAAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold11063:262110..262134 21/25 Antisense off-target kcnk5
Scaffold161503:2574536..2574560 21/25 unknown
tropicalis 7.1 scaffold_5:72092094..72092118 25/25 Antisense target t2
scaffold_3342:2937..2961 21/25 Antisense off-target kcnk5
Publications
First: In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency., Cell Rep 2013                                
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556