Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756310

Morpholino Name: tbx2 MO5
Synonyms: Tbx2MO
mRNA Target: tbx2

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' TTCCAGAGCGAGATAGAGCCCTGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GACAGGGCTCTATCTCGCTCTGGAA 3' ||||||||||||||||||||||||| 3' CTGTCCCGAGATAGAGCGAGACCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold137317:722391..722415 25/25 Antisense off-target tbx2-a
Scaffold47398:1195011..1195035 24/25 Antisense off-target tbx2-b
tropicalis 7.1 scaffold_2:15542007..15542031 25/25 Antisense target tbx2
Publications
First: Tbx2 is required for the suppression of mesendoderm during early Xenopus development., Dev Dyn 2018                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556