Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756311

Morpholino Name: march2 MO1
Synonyms: March2 MO
mRNA Target: march2

Morpholino Type: uncategorized morpholino
Sequence:
5' TCATGGCAACCCTCAGTGCCTTCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' AGGAAGGCACTTTGGGTTGCCATGA 3' ||||||||||| |||||||||||| 3' TCCTTCCGTGACTCCCAACGGTACT 5' 5' AGGAAGGCACTGAGGGTTGCCATGA 3' ||||||||||||||||||||||||| 3' TCCTTCCGTGACTCCCAACGGTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold35716:2040936..2040960 25/25 Antisense target march2
Scaffold39437:133982..134006 23/25 Antisense off-target Xelaev16049920m
Scaffold47457:3276859..3276883 21/25 Antisense off-target Xelaev16056807m
Scaffold52441:10272629..10272653 21/25 unknown
tropicalis 7.1 scaffold_1:125080466..125080490 23/25 Antisense target march2
Publications
First: Head formation requires Dishevelled degradation that is mediated by March2 in concert with Dapper1., Development 2018                
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556