Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756311

Morpholino Name: marchf2 MO1
Synonyms: March2 MO, march2 MO1
Target mRNA: marchf2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCATGGCAACCCTCAGTGCCTTCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' AGGAAGGCACTTTGGGTTGCCATGA 3' ||||||||||| |||||||||||| 3' TCCTTCCGTGACTCCCAACGGTACT 5' 5' AGGAAGGCACTGAGGGTTGCCATGA 3' ||||||||||||||||||||||||| 3' TCCTTCCGTGACTCCCAACGGTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:86861825..86861849 25/25 Antisense target marchf2.S
chr1L:98538236..98538260 23/25 Antisense off-target LOC108712686 [provisional:marchf2]
chr7L:83852727..83852751 21/25 Antisense off-target LOC108696538 [provisional:plch2]
chr1L:197963669..197963693 21/25 unknown
tropicalis 10.0 Chr1:101459796..101459820 23/25 Antisense target marchf2
Publications
First: Head formation requires Dishevelled degradation that is mediated by March2 in concert with Dapper1., Development 2018                
Most recent:
View All Papers