Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756312

Morpholino Name: marchf2 MO2
Synonyms: march2 MO2
Target mRNA: marchf2

Morpholino Type: uncategorized morpholino
Sequence: 5' CAACCCTCAGTGCCTTCCTCCTTTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TAAAGGAGGAAGGCACTGAGGGTTG 3' ||||||||||||||||||||||||| 3' ATTTCCTCCTTCCGTGACTCCCAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:86861819..86861843 25/25 Antisense target marchf2.S
chr1L:98538230..98538254 22/25 Antisense off-target LOC108712686 [provisional:marchf2]
chr2S:3005597..3005621 21/25 Antisense off-target serpinf2.S
chr5L:9629442..9629466 21/25 Antisense off-target rcor3.L
chr1L:9597272..9597296 22/25 unknown
chr1L:181767111..181767135 21/25 unknown
tropicalis 10.0 Chr6:61863126..61863150 21/25 unknown
Publications
First: Head formation requires Dishevelled degradation that is mediated by March2 in concert with Dapper1., Development 2018                
Most recent:
View All Papers