Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756313

Morpholino Name: marchf2 MO3
Synonyms: march2 MO3
Target mRNA: marchf2

Morpholino Type: uncategorized morpholino
Sequence: 5' TGACTCTCCGCTGCCAGACTTTAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' GTAAAGTCTGGCAGCGGAGAGTCA 3' |||||||||||||||||||||||| 3' CATTTCAGACCGTCGCCTCTCAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:86858282..86858305 24/24 Antisense target marchf2.S
chr1L:98533482..98533505 23/24 Antisense off-target LOC108712686 [provisional:marchf2]
chr5L:2955036..2955059 20/24 unknown
tropicalis 10.0 Chr9:52385009..52385032 20/24 Sense off-target bmpr2
Publications
First: Head formation requires Dishevelled degradation that is mediated by March2 in concert with Dapper1., Development 2018                
Most recent:
View All Papers