Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756314

Morpholino Name: dact1 MO3
Synonyms: Dapper1 MO
mRNA Target: dact1

Morpholino Type: uncategorized morpholino
Sequence:
5' GATCGGCTTCATCCTCTGGGAACGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold45985:594256..594280 25/25 Antisense off-target dact1-b
Scaffold1187:428821..428845 22/25 Sense off-target Xelaev16004779m
Publications
First: Head formation requires Dishevelled degradation that is mediated by March2 in concert with Dapper1., Development 2018                
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556