Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756358

Morpholino Name: myo1d MO1
Synonyms:
mRNA Target: myo1d

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCAGCCCCTCTTGTTCCGCCATGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ACATGGCGGAACAAGAGGGGCTACA 3' |||||||||||||||||||||| || 3' TGTACCGCCTTGTTCTCCCCGACGT 5' 5' ACATGGCGGAACAAGAGGGGCTGCA 3' ||||||||||||||||||||||||| 3' TGTACCGCCTTGTTCTCCCCGACGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold75417:2041309..2041333 25/25 Antisense target myo1d
Scaffold14557:8922546..8922570 24/25 Antisense off-target Xelaev16013434m
Scaffold43061:5081473..5081497 22/25 Sense off-target Xelaev16052816m
tropicalis 7.1 scaffold_10:19031682..19031706 24/25 Antisense target myo1d
scaffold_5:115369581..115369605 21/25 unknown
scaffold_5:115369976..115370000 21/25 unknown
Publications
First: A Conserved Role of the Unconventional Myosin 1d in Laterality Determination., Curr Biol 2018                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556